ID: 946410839_946410841

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 946410839 946410841
Species Human (GRCh38) Human (GRCh38)
Location 2:219514466-219514488 2:219514486-219514508
Sequence CCACAAGGAGACGATCGAGGAGA AGAGAGACAAGCGGCAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 1, 2: 5, 3: 28, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!