ID: 946411466_946411481

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 946411466 946411481
Species Human (GRCh38) Human (GRCh38)
Location 2:219517277-219517299 2:219517325-219517347
Sequence CCGGAATCCTGGGGATGGCCTGG GCCCTCTGGTACCCTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 250} {0: 1, 1: 0, 2: 1, 3: 35, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!