ID: 946426732_946426734

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 946426732 946426734
Species Human (GRCh38) Human (GRCh38)
Location 2:219602481-219602503 2:219602497-219602519
Sequence CCTGCGGCGGCGACTTCTGCTCT CTGCTCTGCCCTCCCTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 84} {0: 1, 1: 0, 2: 6, 3: 60, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!