ID: 946428523_946428535

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 946428523 946428535
Species Human (GRCh38) Human (GRCh38)
Location 2:219612769-219612791 2:219612817-219612839
Sequence CCTGTGTCTGCCAAGGAGTTTGG CCACTGAAGGATTTGAAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 217} {0: 1, 1: 1, 2: 4, 3: 57, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!