ID: 946681348_946681358

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 946681348 946681358
Species Human (GRCh38) Human (GRCh38)
Location 2:222220189-222220211 2:222220233-222220255
Sequence CCCGACGGAGGCACAAAGCTGTC CCTGGTGCTGGGGAGGCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75} {0: 1, 1: 0, 2: 8, 3: 79, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!