ID: 946689850_946689865

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 946689850 946689865
Species Human (GRCh38) Human (GRCh38)
Location 2:222301744-222301766 2:222301797-222301819
Sequence CCCGCAGCTGGATGGGAGTCCAG AGGAGTCCTGGTGCCAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 203} {0: 1, 1: 0, 2: 3, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!