ID: 946703773_946703777

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 946703773 946703777
Species Human (GRCh38) Human (GRCh38)
Location 2:222437782-222437804 2:222437821-222437843
Sequence CCTAGTAACAGGCCAAGAGCTGT AGTTATCTGCAGAAAATGGTAGG
Strand - +
Off-target summary {0: 174, 1: 194, 2: 145, 3: 123, 4: 215} {0: 1, 1: 21, 2: 211, 3: 210, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!