|
Left Crispr |
Right Crispr |
| Crispr ID |
946703775 |
946703777 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:222437794-222437816
|
2:222437821-222437843
|
| Sequence |
CCAAGAGCTGTCTCTCAAAAGGA |
AGTTATCTGCAGAAAATGGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 181, 1: 197, 2: 163, 3: 130, 4: 293} |
{0: 1, 1: 21, 2: 211, 3: 210, 4: 306} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|