ID: 946718558_946718560

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 946718558 946718560
Species Human (GRCh38) Human (GRCh38)
Location 2:222579221-222579243 2:222579243-222579265
Sequence CCACAGGCACATAAGGCCTAAAG GCAGAATGTTTTTAAGCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 0, 3: 29, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!