ID: 946747593_946747606

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 946747593 946747606
Species Human (GRCh38) Human (GRCh38)
Location 2:222861293-222861315 2:222861333-222861355
Sequence CCGGTTGGCGGCGCGGCCTCCGC CCGAGGGGCTCCCCAGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 89} {0: 1, 1: 0, 2: 2, 3: 22, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!