ID: 946770812_946770818

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 946770812 946770818
Species Human (GRCh38) Human (GRCh38)
Location 2:223086464-223086486 2:223086477-223086499
Sequence CCCAGCTCCATCTCTGCAAAGTG CTGCAAAGTGGATATTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 251} {0: 1, 1: 0, 2: 1, 3: 18, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!