ID: 946781015_946781023

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 946781015 946781023
Species Human (GRCh38) Human (GRCh38)
Location 2:223193182-223193204 2:223193214-223193236
Sequence CCAGGTAAGTTGAACAGTCCAAT GGTCCCACACAGATGGGACATGG
Strand - +
Off-target summary {0: 2, 1: 92, 2: 380, 3: 272, 4: 138} {0: 82, 1: 298, 2: 258, 3: 133, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!