ID: 946881917_946881924

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 946881917 946881924
Species Human (GRCh38) Human (GRCh38)
Location 2:224185102-224185124 2:224185154-224185176
Sequence CCCTGGGTACTGTCTAGGAGGAA CTGAATGCTGAAACCAAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!