ID: 946935329_946935336

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 946935329 946935336
Species Human (GRCh38) Human (GRCh38)
Location 2:224714386-224714408 2:224714430-224714452
Sequence CCACAGAGAATAGACTTGAAGTA CGGTGGTTTTCAATGGTGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!