ID: 946954996_946954998

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 946954996 946954998
Species Human (GRCh38) Human (GRCh38)
Location 2:224920041-224920063 2:224920077-224920099
Sequence CCAATTTGGATCTTATTATTTAC TTGCTGTTGTTGTTGAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 352} {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!