ID: 947000875_947000885

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 947000875 947000885
Species Human (GRCh38) Human (GRCh38)
Location 2:225454776-225454798 2:225454817-225454839
Sequence CCCCTCCCCATCTGTGGAAAAAG TCCCTGGTGCCAAAAAGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 153, 4: 486} {0: 92, 1: 1191, 2: 1775, 3: 1334, 4: 906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!