ID: 947017323_947017327

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 947017323 947017327
Species Human (GRCh38) Human (GRCh38)
Location 2:225635708-225635730 2:225635730-225635752
Sequence CCCTTTTTGGGTTGCCTTGAGTC CTGCATTTATAGATGGAATTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 145} {0: 1, 1: 0, 2: 1, 3: 31, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!