ID: 947126900_947126907

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 947126900 947126907
Species Human (GRCh38) Human (GRCh38)
Location 2:226878719-226878741 2:226878766-226878788
Sequence CCTTCTGAATTCCTGACCCACAG TCTTTGGTCCCACTAGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 28, 3: 62, 4: 332} {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!