ID: 947132218_947132222

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 947132218 947132222
Species Human (GRCh38) Human (GRCh38)
Location 2:226940442-226940464 2:226940472-226940494
Sequence CCACGTTGTTAAAAATATTAGGT TGCCATTTAAGTCTTGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144} {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!