ID: 947163869_947163872

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 947163869 947163872
Species Human (GRCh38) Human (GRCh38)
Location 2:227241747-227241769 2:227241761-227241783
Sequence CCAAAGCCAACCTACTGCATATG CTGCATATGTACTCTGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115} {0: 1, 1: 0, 2: 6, 3: 86, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!