ID: 947328302_947328309

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 947328302 947328309
Species Human (GRCh38) Human (GRCh38)
Location 2:229001696-229001718 2:229001726-229001748
Sequence CCTAACACCTAATGTAGCAGCAT TGGGGCTTTCGGCAGGTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160} {0: 1, 1: 0, 2: 7, 3: 39, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!