ID: 947404974_947404975

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 947404974 947404975
Species Human (GRCh38) Human (GRCh38)
Location 2:229765907-229765929 2:229765921-229765943
Sequence CCACTTAATGGGGTCACTGCCCA CACTGCCCAAGTGAACTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106} {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!