ID: 947464908_947464911

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 947464908 947464911
Species Human (GRCh38) Human (GRCh38)
Location 2:230334568-230334590 2:230334583-230334605
Sequence CCATTCCAGTGTTGGATTTACAT ATTTACATGTATTTTATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 172} {0: 1, 1: 1, 2: 3, 3: 76, 4: 731}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!