ID: 947586228_947586234

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 947586228 947586234
Species Human (GRCh38) Human (GRCh38)
Location 2:231358538-231358560 2:231358569-231358591
Sequence CCCAGGCAGCGCTCCCCACAGGT ACACAGCTCGCTGCTGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154} {0: 1, 1: 0, 2: 1, 3: 15, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!