ID: 947592975_947592980

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 947592975 947592980
Species Human (GRCh38) Human (GRCh38)
Location 2:231395705-231395727 2:231395718-231395740
Sequence CCGGTCTCCGTCCCCACCCGCCC CCACCCGCCCGCCGTCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 723} {0: 1, 1: 0, 2: 7, 3: 24, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!