ID: 947641154_947641164

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 947641154 947641164
Species Human (GRCh38) Human (GRCh38)
Location 2:231708570-231708592 2:231708609-231708631
Sequence CCGCCTCCTTGCTCGCCGCAGCC TCCTCCGCCGCCGCGGACTCCGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 4, 3: 30, 4: 379} {0: 3, 1: 3, 2: 1, 3: 10, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!