ID: 947698539_947698544

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 947698539 947698544
Species Human (GRCh38) Human (GRCh38)
Location 2:232213342-232213364 2:232213373-232213395
Sequence CCTGAGGAGCAGTTTGGCAGAGC AAGGACATGGAAAAGGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 153} {0: 1, 1: 0, 2: 4, 3: 43, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!