ID: 947750684_947750693

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 947750684 947750693
Species Human (GRCh38) Human (GRCh38)
Location 2:232530420-232530442 2:232530449-232530471
Sequence CCAAGTCCCTCACGGTCACCAGT CCGTGGGCCTGGCACACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116} {0: 1, 1: 0, 2: 8, 3: 107, 4: 666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!