ID: 947776553_947776558

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 947776553 947776558
Species Human (GRCh38) Human (GRCh38)
Location 2:232716469-232716491 2:232716493-232716515
Sequence CCCGCGTTCAAGCAATCCTCATG CTCAGTCATCCCTACTAGCTGGG
Strand - +
Off-target summary {0: 2, 1: 62, 2: 3404, 3: 51770, 4: 143683} {0: 1, 1: 0, 2: 0, 3: 53, 4: 576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!