ID: 947821319_947821328

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 947821319 947821328
Species Human (GRCh38) Human (GRCh38)
Location 2:233073070-233073092 2:233073097-233073119
Sequence CCATCCCCCCTTCACTCACCCTG TGCCTCGCTTCAGCCAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 137, 4: 1874} {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!