ID: 947838714_947838717

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 947838714 947838717
Species Human (GRCh38) Human (GRCh38)
Location 2:233193763-233193785 2:233193790-233193812
Sequence CCATGAAAAGGCAGGGTCTTCAC CTGTCTCCCACTTTCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 180} {0: 1, 1: 0, 2: 4, 3: 41, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!