ID: 947872095_947872102

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 947872095 947872102
Species Human (GRCh38) Human (GRCh38)
Location 2:233444881-233444903 2:233444918-233444940
Sequence CCTTCATGGCCCTGGTCACTCTG GGCTGGTGAGCTCTGGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 352} {0: 1, 1: 0, 2: 5, 3: 79, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!