ID: 947904362_947904376

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 947904362 947904376
Species Human (GRCh38) Human (GRCh38)
Location 2:233749629-233749651 2:233749674-233749696
Sequence CCCCACCAAATCTCATCTTGAAT TGTCAAGGACAGGATCTGGTGGG
Strand - +
Off-target summary {0: 51, 1: 484, 2: 9423, 3: 13717, 4: 13677} {0: 1, 1: 0, 2: 14, 3: 114, 4: 743}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!