ID: 947909692_947909705

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 947909692 947909705
Species Human (GRCh38) Human (GRCh38)
Location 2:233792904-233792926 2:233792953-233792975
Sequence CCACTTGAGCCTGCAGGTCTGGC CTGGGTAAGGAGCAGATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 231} {0: 1, 1: 0, 2: 6, 3: 44, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!