ID: 947913142_947913154

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 947913142 947913154
Species Human (GRCh38) Human (GRCh38)
Location 2:233814704-233814726 2:233814739-233814761
Sequence CCAGGGATGGCCACTCCTCCCCA AGGGCCAGACTCTGGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 334} {0: 1, 1: 0, 2: 1, 3: 19, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!