ID: 947915827_947915839

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 947915827 947915839
Species Human (GRCh38) Human (GRCh38)
Location 2:233831089-233831111 2:233831118-233831140
Sequence CCTGCTCAAGCCCGGCTCCCGCC CCCATGGAGGGCTGGGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 435} {0: 1, 1: 0, 2: 4, 3: 54, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!