ID: 948042801_948042809

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 948042801 948042809
Species Human (GRCh38) Human (GRCh38)
Location 2:234917028-234917050 2:234917052-234917074
Sequence CCACCTGGTCCCCTCATTGCCAG GCCACAGTGCTCAGAAAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!