ID: 948120710_948120727

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 948120710 948120727
Species Human (GRCh38) Human (GRCh38)
Location 2:235528323-235528345 2:235528364-235528386
Sequence CCATCCACCATCTGTGCACTCAG GCCCCCTCCCCTCCCACTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 719} {0: 1, 1: 1, 2: 3, 3: 61, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!