ID: 948132322_948132331

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 948132322 948132331
Species Human (GRCh38) Human (GRCh38)
Location 2:235609770-235609792 2:235609803-235609825
Sequence CCCAACTCACAGGCCAGAAAGTG CTGTGGGCATATTTGGCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 235} {0: 1, 1: 0, 2: 2, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!