ID: 948136275_948136283

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 948136275 948136283
Species Human (GRCh38) Human (GRCh38)
Location 2:235638774-235638796 2:235638792-235638814
Sequence CCAGGAAGCTGGTTACAACCCAG CCCAGGCGGAGGGCTGGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 148} {0: 1, 1: 0, 2: 0, 3: 21, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!