ID: 948137779_948137787

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 948137779 948137787
Species Human (GRCh38) Human (GRCh38)
Location 2:235649657-235649679 2:235649705-235649727
Sequence CCACAGTGGCTGGCCGAGATTGT TGTGCTGATGCTGCTTGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 582} {0: 1, 1: 1, 2: 22, 3: 188, 4: 720}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!