ID: 948158094_948158103

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 948158094 948158103
Species Human (GRCh38) Human (GRCh38)
Location 2:235800864-235800886 2:235800913-235800935
Sequence CCTGTTTTAAACCATCTGACTTC GATGCAAAGCTCTAGAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 361} {0: 1, 1: 0, 2: 1, 3: 15, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!