ID: 948201329_948201337

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 948201329 948201337
Species Human (GRCh38) Human (GRCh38)
Location 2:236131412-236131434 2:236131465-236131487
Sequence CCAGTTTTCTGTTTCTGTAAATA GTGTATCCACAGATGGGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 140, 4: 1220} {0: 1, 1: 0, 2: 0, 3: 8, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!