ID: 948248672_948248692

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 948248672 948248692
Species Human (GRCh38) Human (GRCh38)
Location 2:236507603-236507625 2:236507633-236507655
Sequence CCTGCCCCCTCCCCCCCCCCGCC TTCCGCGCCTGCGCCACCGCGGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 272, 3: 2438, 4: 19411} {0: 1, 1: 0, 2: 0, 3: 13, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!