ID: 948257467_948257480

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 948257467 948257480
Species Human (GRCh38) Human (GRCh38)
Location 2:236578477-236578499 2:236578530-236578552
Sequence CCCTCCATGGAAGGCTTTCAGAG CCAGCCCTTTCTGTCAGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 169} {0: 1, 1: 0, 2: 2, 3: 13, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!