ID: 948274044_948274054

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 948274044 948274054
Species Human (GRCh38) Human (GRCh38)
Location 2:236694790-236694812 2:236694834-236694856
Sequence CCTGGGTGGGGGCTGGGCCCCTC CCCAGCCGATCTCCACTATGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!