ID: 948281059_948281071

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 948281059 948281071
Species Human (GRCh38) Human (GRCh38)
Location 2:236748340-236748362 2:236748380-236748402
Sequence CCCTCATGTCTTGGTTCTGTCTT GAAGTGGCTGGCTCAGGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 47, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!