ID: 948359764_948359767

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 948359764 948359767
Species Human (GRCh38) Human (GRCh38)
Location 2:237412006-237412028 2:237412019-237412041
Sequence CCAAGCCCTCTGCTCCACTCAGT TCCACTCAGTGTCTGCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 371} {0: 1, 1: 0, 2: 8, 3: 67, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!