ID: 948370069_948370077

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 948370069 948370077
Species Human (GRCh38) Human (GRCh38)
Location 2:237483273-237483295 2:237483302-237483324
Sequence CCAAGGCCACCCCTCAGTGGGAC GACCAGTTATCCTTGGAACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!