ID: 948406314_948406320

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 948406314 948406320
Species Human (GRCh38) Human (GRCh38)
Location 2:237722725-237722747 2:237722755-237722777
Sequence CCTAATGTTTATAGGCACCAAAC GAGTGGTGAAGAGGCCTGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142} {0: 1, 1: 0, 2: 1, 3: 16, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!